Stabilny, utajony rezerwuar dla HIV-1 w spoczynkowych limfocytach T CD4 + u zakażonych dzieci ad

Podczas gdy wykazano, że kinetyka rozpadu wolnego wirusa w osoczu dzieci leczonych HAART jest podobna do obserwowanej u dorosłych (8, 9), istnienie ukrytego rezerwuaru komórkowego dla dzieci zakażonych HIV-1. ustalono kinetykę i ewolucję utajonego HIV-1 w spoczynkowych limfocytach T CD4 + u dzieci leczonych HAART. A priori istnieje kilka powodów, aby sądzić, że dynamika utajonego zbiornika może być inna u dzieci z perinatally nabytym zakażeniem HIV-1 niż u dorosłych. U dzieci, które nabyły HIV-1 od swoich matek, zakażenie ustala się w warunkach rozwijającego się repertuaru komórek T, w obecności wysokiego poziomu replikacji wirusa i w obecności niedoboru aktywności cytotoksycznych komórek T (17. 22). ), a można nawet oczekiwać, że częstotliwość spoczynkowych komórek T CD4 + ze zintegrowanym HIV-1 będzie wyższa u zarażonych dzieci. U dorosłych większość ukrytego wirusa w spoczynkowych komórkach T CD4 + znajduje się w komórkach z fenotypem pamięci (23). Przy urodzeniu komórki pamięci są nieobecne. W pierwszej dekadzie życia komórki pamięci są generowane i stanowią około 50% całkowitej populacji limfocytów T w wieku 15 lat (24). Ponieważ u okołoporodowo zakażonych dzieci przedział komórek pamięci jest aktywnie wytwarzany w warunkach trwającej replikacji wirusa, istniało obawy, że zostanie utworzony duży rezerwuar komórek T CD4 + spoczynkowych z pamięcią spoczynkową. Niniejsze badanie zostało podjęte w celu ustalenia obecności utajonego rezerwuaru HIV-1 u zakażonych dzieci, w celu odniesienia się do hipotezy, że częstość komórek latentnie zakażonych może być wyższa u dzieci niż u dorosłych oraz do określenia kinetyki i ewolucji utajonej HIV-1 w spoczynkowych limfocytach T CD4 + u dzieci, u których HAIR uodpornił je na anirem. Metody Badanie populacji. Dzieci z zakażeniem okołoporodowym zakażeniem HIV-1 były uprawnione. Zakażenie zostało zdiagnozowane u dzieci w wieku powyżej 18 miesięcy za pomocą testu ELISA HIV-1 z potwierdzeniem Western blot. U dzieci w wieku poniżej 18 miesięcy zakażenie potwierdzono przez wykrycie RNA HIV-1 w osoczu. Świadoma zgoda została uzyskana od rodzica lub opiekuna wszystkich badanych i uzyskano zgodę od tych dzieci, które były świadome swojej diagnozy. RNA osocza HIV-1. RNA HIV-1 osocza mierzono za pomocą PCR RNA HIV-1 (test monitorujący Amplicor HIV-1, Roche Diagnostic Systems, Branchburg, New Jersey, USA). Test hodowlany dla komórek zakażonych latentnie. Odpoczynkowe limfocyty T CD4 + izolowano jak opisano uprzednio (3, 12, 23), stosując ubytki perełek mAb / magnetycznych monocytów, komórek naturalnych zabójców (NK), komórek B, komórek T CD8 + i aktywowanych komórek T CD4 +, a następnie sortowano do małe komórki CD4 + HLA-DR .. Czystość określano za pomocą cytometrii przepływowej sortowanych komórek pod kątem ekspresji CD4 i braku HLA-DR. Czystość była zwykle większa niż 97%. W przypadku dzieci, u których trudno było hodować HIV-1 od 2 do 5 milionów oczyszczonych spoczynkowych limfocytów CD4 +, pominięto etap sortowania komórek i zbadano komórki zubożone w kulki (czystość 90%, dane nie przedstawione). Komórki trwale zakażone wykrywano za pomocą wcześniej opisanego testu (5, 23) ograniczającej hodowli po rozcieńczeniu, w którym oczyszczone komórki CD4 + HLA-DR3 aktywowano fitohemaglutyniną i napromieniowanymi alogenicznymi PBMC od seronegatywnego donora HIV-1 w pożywce zawierającej IL-2, a następnie współhodowano z opuszczonymi CD8 limfoblastami CD4 + od seronegatywnego dawcy HIV-1. Supernatanty zebrano w dniu 14 i analizowano na obecność antygenu p24 za pomocą ELISA (Coulter Electronics Ltd., Hialeah, Floryda, USA). Metody matematyczne i statystyczne. Dane dotyczące hodowli wirusów analizowano metodą największej wiarygodności (25). Częstotliwości wyrażano jako komórki zakaźne na milion (IUPM) spoczynkowych komórek CD4 +. W przypadkach, w których wszystkie oznaczenia były ujemne, górną granicę na częstotliwości zainfekowanej komórki oszacowano, przyjmując konserwatywne założenie, że następne najwyższe stężenie komórek będzie dodatnie. Korelacje między poziomami IUPM i RNA w osoczu (wykreślone w skali logarytmicznej) i procentem CD4 zostały wykonane za pomocą metod korelacji rang Spearmana i testu Manna-Whitneya-Wilcoxona. Sekwencjonowanie genu pol HIV-1. Sekwencje pol HIV-1 amplifikowano za pomocą PCR z DNA związanego z komórką z hodowli limfoblastów CD4 + zainfekowanych wirusami izolowanymi z komórek latiennie zakażonych. Genomowy DNA izolowano przy użyciu standardowych metod (Gentra Systems Inc., Minneapolis, Minnesota, USA). Gen pol amplifikowano stosując opublikowane startery z primerem PRT O5 (nukleotydy od 2008 do 2031; 5. GCCCCTAGGAAAAAGGGCTGTTGG3) i OUT3. (nukleotydy od 4263 do 4295, 5 (3TCTCTCTCCAAT-TACTGTGATATTTCTCATG3 .) lub PRT15 (nukleotydy 2057 do 2080, 5 (3TGAAAGATTGT-ACTGAGAGACAGG3a) i IN3 (nukleotydy 4212 do 4246; 5aTCTATTCCATCTAAAA-ATAGTACTTTCCTGATTCC3.)
[patrz też: królestwo pierożka, globulki dopochwowe przeciwzapalne, kariotyp osoby z zespołem downa ]
[hasła pokrewne: u romana kraków, papryczki 5, motochemia ]