Polimorfizm miejsca wiązania Sp1 COL1A1 predysponuje do złamania osteoporotycznego przez wpływ na gęstość i jakość kości ad

Średni. Wiek SD tych pacjentów wynosił 79. 12,2 lat. Przeprowadzono badania biomechaniczne na próbkach kości beleczkowej z główek kości udowej uzyskanych od 17 kobiet i 6 mężczyzn w wieku średnim. Wiek SD 76,3. 8,4 roku. W 17 przypadkach pobrano próbki kości z główek kości udowej usuniętych od pacjentów przechodzących operację wymiany stawu biodrowego w wyniku złamania osteoporotycznego. W pozostałych sześciu przypadkach próbki pobrano podczas sekcji zwłok od osób bez znanej historii chorób kości, które zmarły nagle. Żaden z pacjentów biorących udział w żadnym z tych badań nie otrzymał leków, o których wiadomo, że wpływają na metabolizm wapnia, takich jak kortykosteroidy, bisfosfoniany, kalcytoniny lub aktywne metabolity witaminy D. Badanie zostało zatwierdzone przez lokalny komitet etyczny szpitala, a wszyscy pacjenci lub ich krewni świadoma zgoda na uwzględnienie próbek tkanek. Testy zmiany ruchliwości elektroforetycznej. Sensowne i antysensowne oligonukleotydy odpowiadające AS. allel (AGGGAATGGGGGCGGGATGAGGGCCT) i. s. allel (AGGGAATGTGGGCGGGATGAGGGCCT) (pokazano nić sensową, miejsce wiązania Sp1 i polimorficzną zasadę pogrubioną czcionką) zsyntetyzowano, hybrydyzowano i znakowano końcowo za pomocą. 32P-ATP (Amersham Pharmacia Biotech UK Ltd., Buckinghamshire, Wielka Brytania) stosując T4. Kinaza polinukleotydowa (Promega Corp., Madison, Wisconsin, USA). Znakowane oligonukleotydy (0,04 uM) inkubowano w 30 ° C przez 30 minut z ludzkim rekombinowanym Sp1 (hrSp1; 10 ng; Promega Corp.); BSA (20 .g, Promega Corp.); i różne stężenia. S. lub. s. nieznakowane konkurencyjne oligonukleotydy. W niektórych doświadczeniach użyto przeciwciała anty Sp1 (2 .g, Santa Cruz Biotechnology, Santa Cruz, California, USA) w celu potwierdzenia swoistości wiązania. Próbki analizowano na 4% żelu poliakrylamidowym i wizualizowano za pomocą Bio-Rad Personal Molecular Imager, a intensywność pasma oznaczano ilościowo za pomocą oprogramowania Quantity One (oba, Bio-Rad Laboratories Inc., Hercules, California, USA). Transkrypcja specyficzna dla alleli. Allelową specyficzną transkrypcję oceniano za pomocą pół-zagnieżdżonego testu RT-PCR zaprojektowanego do wykrywania względnej obfitości niepodzielonego jądra jądrowego RNA pochodzącego z każdego allelu, w oparciu o analizę RFLP utworzonego przez polimorficzne miejsce Sp1 w intronie (Figura 3a). Całkowity RNA wyekstrahowano z próbek kości transiliaka lub pierwotnych ludzkich osteoblastów uzyskanych od pacjentów heterozygotycznych pod względem polimorfizmu przy użyciu metody opartej na tiocyjanianie opartej na kwasie fenolowo-guanidynowym, jak opisano wcześniej (21). Komplementarny DNA (cDNA) został przygotowany przez odwrotną transkrypcję 5 .g całkowitego RNA od każdego pacjenta za pomocą SuperScript RNaseH. RT (200 U, Life Technologies Ltd., Paisley, Wielka Brytania) z losowymi starterami heksamerowymi według protokołu producenta. Pierwsza runda pół-zagnieżdżonego PCR została przeprowadzona z następującym zestawem starterów: 5. – TAACTTCTGGACTATTTGCGGACTTTTTGG. 3. (p1) i 5 GGGCGAGGGAGGAGAGAA. 3. (p3), który amplifikuje region 283 bp otaczający miejsce polimorficzne w pierwszym intronie COL1A1. Protokół z cyklem termicznym wynosił: 95 ° C przez 2 minuty, 58 ° C przez minutę, 72 ° C przez minutę (jeden cykl), 95 ° C przez 50 sekund, 58 ° C przez minutę, 72 ° C przez minutę. minuta (13 cykli); 95 ° C przez 50 sekund, 58 ° C przez minutę, 72 ° C przez 3 minuty (jeden cykl). Nierozcieńczone produkty z tej reakcji wykorzystano jako matrycę w drugiej rundzie PCR, stosując fluorescencyjnie znakowany przedni starter o tej samej sekwencji jak w pierwszej rundzie i następujący starter odwrotny: 5. GTCCAGCCCTCATCCTGGCC. 3. (p2), który wprowadza miejsce restrykcyjne dla enzymu MscI w produktach otrzymanych z A. allel (3). W drugiej rundzie PCR zastosowano następujący protokół termiczny: 94 ° C przez 3 minuty, 62 ° C przez 10 sekund, rosnące z szybkością ° C przez 10 sekund do 72 ° C, 72 ° C przez 15 sekund (jeden cykl); 94 ° C przez 50 sekund, 62 ° C przez 10 sekund, wzrastanie ° C przez 10 sekund do 72 ° C, 72 ° C przez 15 sekund (26 cykli); 94 ° C przez 50 sekund, 62 ° C przez 10 sekund, rosnące ° C przez 10 sekund do 72 ° C, 72 ° C przez 5 minut (jeden cykl). Transkrypty swoiste dla allelu wykrywano przez trawienie produktów drugiej rundy PCR enzymem restrykcyjnym MscI i oznaczano ilościowo za pomocą elektroforezy z użyciem sekwensera ABI 377 i oprogramowania GeneScan (Applied Biosystems, Warrington, Wielka Brytania). Wyniki wyrażono jako stosunek. S. allelu obfitości produktu do. S. obfitość produktu allelowego. W każdym oznaczeniu amplifikowano próbkę genomowego DNA i RNA, które nie uległy odwrotnej transkrypcji od tego samego pacjenta, razem z próbką cDNA w celu kontrolowania możliwych allelospecyficznych różnic w wydajności PCR i kontaminacji cDNA genomowym DNA.
[patrz też: pijalnia wódki i piwa kraków, nadczynność tarczycy leki, grudziądz jednostka wojskowa ]
[patrz też: genji sushi, królestwo pierożka, pompon komis ]