Geny związane z uczuleniem macicy a 1 (USAG-1), nowy antagonista BMP eksprymowany w nerce, przyspiesza uszkodzenie rurki ad 7

Wprowadziliśmy gen nlacZ i kasetę PGK-NeoR w przeciwnej orientacji transkrypcyjnej do genu USAG1. Komórki ES transfekowano liniowym wektorem docelowym przez elektroporację i selekcjonowano za pomocą pożywki zawierającej G418. Homologiczne rekombinanty badano i identyfikowano za pomocą genomowej analizy Southern blot z mapowaniem sond HincII-EcoRI poza 5. ramię homologiczne (rysunek 1A). Uzyskano homologiczne rekombinowane klony komórek ES, a prawidłową rekombinację potwierdzono metodą Southern blot (Figura 1B), jak również analizy PCR. Komórki ES niosące allel USAG1-zerowy wstrzyknięto do blastocyst C57BL / 6, aby uzyskać chimeryczne myszy, które krzyżowano z myszami C57BL / 6J typu dzikiego. Po przeniesieniu linii płciowej myszy utrzymywano w mieszanym podłożu SvJ. Genotypowanie PCR zastosowano we wszystkich kolejnych badaniach w celu umożliwienia specyficznej detekcji zarówno typu dzikiego, jak i USAG1. /. allele (Figura 1C). Sekwencje starterów stosowanych do genotypowania są następujące: F1, CCCCTCCTCATCTGGCTGCTTCCTAAACGG; R1, CAGTCACGACGTTGTAAAACGACGGGATCC; F2, GGGATCCCACCCCTTCTCT; i R2, GCCGGGACAGGTTTAACCA. Wykorzystanie zwierząt. Wszystkie eksperymenty z wyjątkiem tych przedstawionych na uzupełniającej figurze 3 przeprowadzono przy użyciu USAG1. /. myszy i ich rodzeństwa z miotu dzikiego (USAG1 + / +) generacji F2. Wszystkie myszy były trzymane w określonych warunkach wolnych od patogenu. Doświadczenia przedstawione na Suplementowej Figurze 3 przeprowadzono z użyciem myszy C57BL / 6. Wszystkie eksperymenty na zwierzętach zostały zatwierdzone przez Komitet Badań nad Zwierzętami w Graduate School of Medicine na Uniwersytecie w Kioto oraz Komitet Eksperymentu Zwierząt i Użytkowania na Uniwersytecie Tsukuba i były zgodne z wytycznymi NIH. Podawanie cisplatyny. Cisplatynę (Sigma-Aldrich) podawano myszom w dawce 20 mg / kg przez pojedyncze wstrzyknięcie dootrzewnowe. Myszy uśmiercono 72 godziny po podaniu cisplatyny, a tkankę i krew zebrano do dalszej analizy. UUO. Kompletne UUO przeprowadzono zgodnie z wcześniejszym opisem (46). Pokrótce, pod znieczuleniem pentobarbitalem sodu, środkową część lewego moczowodu zligowano i pocięto między 2 punkty ligacji. Po 14 dniach od operacji myszy uśmiercano, a zatkane nerki poddawano badaniom opisanym poniżej. Badania histologiczne. Nerki zostały utrwalone w roztworze Carnoya i osadzone w parafinie. Skrawki (2 .m) wybarwiono PAS do rutynowego badania histologicznego, a stopień zmian morfologicznych określono za pomocą mikroskopii świetlnej. Następujące parametry wybrano jako wskazujące na morfologiczne uszkodzenie nerek po iniekcji cisplatyny i UUO: utratę granicy szczotki, rozszerzenie kanalika, zwyrodnienie kanalika i martwicę kanalików. Te parametry oceniano w skali od 0 do 4 i klasyfikowano jako: 0, nieobecne; 1, łagodny; 2, umiarkowane; 3, poważne; i 4, bardzo poważne. Pozostała nerka została wykorzystana do badań immunohistochemicznych, izolacji RNA i ekstrakcji białka. Immunobarwione. Zamrożone odcinki nerek poddano immunobarwieniu poliklonalnymi przeciwciałami przeciwko kolagenowi typu IV (ICN Pharmaceuticals), fosforylowanej Smadl / 5/8 (Cell Signaling Technology) i fosforylowanej Smad2 / 3 (Santa Cruz Biotechnology Inc.) i przeciwciałach monoklonalnych przeciwko. – SMA (Sigma-Aldrich) i Mac-1 (BD Biosciences. Pharmingen), jak opisano wcześniej (47, 48). Immunoblot. Całe białko nerkowe homogenizowano w buforze RIPA (50 mM Tris w pH 7,5, 150 mM NaCl, 1% Nonidet P-40, 0,25% SDS, mM Na3VO4, 2 mM EDTA, mM PMSF i 10 ug / ml aprotyniny ) i poddano immunoblottingu, jak opisano wcześniej (49). Przeciwciało anty-E-kadheryny i przeciwciało anty-GAPDH pochodziło od BD Biosciences. Transduction Laboratories i Research Diagnostic Inc., odpowiednio. Wykrywanie apoptoz i oznaczanie ilościowe. Do wykrycia komórek apoptotycznych in situ zastosowano technikę TUNEL (zestaw do wykrywania śmierci komórek In Situ, Roche Diagnostics GmbH). Zliczono wszystkie jądra apoptotyczne w przekroju poprzecznym miedniczki nerkowej. Oznaczanie ilościowe mRNA za pomocą RT-PCR w czasie rzeczywistym. RT-PCR w czasie rzeczywistym został przeprowadzony przy użyciu 7700 System Wykrywania Sekwencji (Applied Biosystems). Pięć mikrogramów całkowitego RNA poddano odwrotnej transkrypcji w objętości reakcji 20 .l, stosując odwrotną transkryptazę Superscript III i losowe startery (Invitrogen Corp.). Produkt rozcieńczono do objętości 400 .l, a próbki 5 .l zastosowano jako matryce do amplifikacji z zastosowaniem odczynnika do amplifikacji PCR SYBR Green (Applied Biosystems) i starterów specyficznych dla genu. Konkretne startery dla każdego transkryptu genu (wymienione w Tabeli 1) zaprojektowano przy użyciu oprogramowania Primer Express w wersji 2.0.0 (Applied Biosystems) i sprawdzono, czy wykazały one pojedynczy pik w krzywej dysocjacji.
[przypisy: moja historia odchudzania, cukiernia michalscy, grudziądz jednostka wojskowa ]
[patrz też: vanilla komis, cukiernia michalscy, centrum tanich podręczników ]